Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie ad 8

Ponadto, RNA wyekstrahowano i przeprowadzono PCR z odwrotną transkrypcją (RT-PCR) dla celów specyficznych dla różnych wirusów RNA, w tym influenzawirusów A i B, syncytialnego wirusa oddechowego, podtypów 1, 2, 3 i 4 wirusa paragrypy, metapneumowirusa ludzkiego filowirusy (wirusy Ebola i Marburg), arenawirusy, wirus odry, wirus świnki, wirusy Hanta i wirus gorączki krwotocznej krymskiej-Kongo, dające negatywne wyniki. Przeprowadzono dalsze badania wirusologiczne na wszystkich próbkach oddechowych otrzymanych od 9 z 10 pacjentów. Obejmowały one hodowle wirusowe (w tym inokulację na hodowlę komórkową i jaja kurze z zarodkami oraz inokulację wewnątrzmózgową myszy karmionych piersią), mikroskopię elektronową odpornościową wymazów nosowo-gardłowych i płynów oskrzelowo-pęcherzykowych z surowicą otrzymaną podczas fazy rekonwalescencji z Pacjenta 10, RT-PCR dla konserwatywnych części gen polimerazy wirusów RNA i zagnieżdżony RT-PCR z degeneracyjnymi starterami swoistymi dla paramyksowirusów i buniawirusów. Wyniki wszystkich tych testów były ujemne, z dwoma wyjątkami. Ludzki metapneumowirus amplifikowano za pomocą zagnieżdżonego RT-PCR z płynu płuczącego oskrzelowo-pęcherzykowego i wymazów z nosogardzieli z pięciu z dziewięciu pacjentów z SARS i z wymazu z nosa i gardła od bezobjawowego kontaktu jednego z pacjentów w Toronto (Pacjent 3) z użyciem następującego startera para: 5 CTTTGGACTTAATGACAGATG3 i 5 GTCTTCCTGTGCTAACTTTG3 .4 W celu potwierdzenia tych pozytywnych wyników amplikony zostały zsekwencjonowane i uznane za unikalne, co wyklucza możliwość zanieczyszczenia krzyżowego w laboratorium.
Ponadto wyizolowano nowego koronawirusa z hodowli komórek Vero zaszczepionych materiałami oddechowymi od pięciu z dziewięciu pacjentów z SARS. Czterech z tych pacjentów miało próbki, z których zidentyfikowano także metapneumowirus. Efekt cytopatyczny na hodowlach komórek Vero zanotowano w 6 dniu inkubacji. Na podstawie współpracy z badaczami z Hongkongu oraz z Centers for Disease Control and Prevention (CDC) w Atlancie, którzy zgłosili izolację nowego koronawirusa od pacjentów z SARS w innych częściach świata, RT-PCR został zakończony z naciskiem na konserwatywne regiony genu polimerazy koronawirusa, stosując następującą parę primerów: 5 CAGAGCCATGCCTAACATG3 i 5 AATGTTTACGCAGGTAAGCG3 . Nowy koronawirus identyczny z raportowanym przez CDC2 został zamplifikowany ze wszystkich pięciu kultur. Ponadto, zagnieżdżony RT-PCR wykorzystujący te same startery plus 5 TGTTAAACCAGGTGGAAC3 i 5 CCTGTGTTGTAGATTGCG3 zamplifikował koronawirus bezpośrednio z płukania oskrzelowo-pęcherzykowego z trzech z dziewięciu badanych pacjentów, z których wszyscy mieli również koronawirus wyizolowany z hodowli komórkowej, jak opisano powyżej. .
W innym laboratorium koronawirus zidentyfikowano również niezależnie przez amplifikację bezpośrednio z płynu płuca oskrzelowo-pęcherzykowego od trzech z sześciu badanych pacjentów. Wszyscy trzej z tych pacjentów mieli koronawirusa wyizolowanego z hodowli komórkowej i amplifikacji, jak opisano powyżej. Odwrotna transkrypcja została zakończona przy użyciu startera 5 GCATAGGCAGTAGTTGCATC3 , a następnie PCR skierowanego do wysoce konserwatywnego regionu genu polimerazy koronawirusa przy użyciu pary primerów 5 TGATGGGATGGGACTATCCTAAGTGTGA3 i 5 TTGCATCACCACTAGTTGTGCCACCAGGTT3
[więcej w: stwardnienie rozsiane blog, nfz wrocław sanatoria lista oczekujących, hcv cena ]
[więcej w: plastyka powłok brzusznych, skierowanie na zabiegi fizjoterapeutyczne druk, nfz poznań przeglądarka skierowań ]