Przypadek 27-2002: późnokomórkowa infekcyjna neuronalna lipofuscyoza Ceroidów

Rust i Karluk (wydanie 29 sierpnia) omawiają przypadek dziecka z zaburzeniem neurodegeneracyjnym, u którego stwierdzono krzywoliniowe cienie inkluzji lizosomalnych na podstawie analizy mikroskopowej elektronowej próbki z biopsji mięśniowej. Rozpoznano późną infekcyjną neuronalną ceroidalną lipofuscyozę. Podejście do potwierdzenia tej diagnozy jest zastanawiające.
Autorzy wspominają, że kolejne testy molekularne dla dwóch powszechnych mutacji CLN2 nie pozwoliły na zidentyfikowanie mutacji, ale nie przeprowadzono testów enzymatycznych. Biorąc pod uwagę fakt, że tylko 66 procent pacjentów z klinicznie rozpoznaną późną infekcją neuronalnej infekcyjnej lipofuscykozy ceroidowej ma mutacje w CLN2, 2 bardziej ostrożnym podejściem byłoby po pierwsze udokumentowanie niedoboru enzymu tripeptydylo-peptydazy I (TPP-I) , produkt białkowy CLN2. Read more „Przypadek 27-2002: późnokomórkowa infekcyjna neuronalna lipofuscyoza Ceroidów”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie

Ciężki zespół ostrej niewydolności oddechowej (SARS) to stan nieznanej przyczyny, który niedawno został rozpoznany u pacjentów w Azji, Ameryce Północnej i Europie. W niniejszym raporcie podsumowano wstępne ustalenia epidemiologiczne, opis kliniczny i ustalenia diagnostyczne, które nastąpiły po identyfikacji SARS w Kanadzie. Metody
SARS został po raz pierwszy zidentyfikowany w Kanadzie na początku marca 2003 r. Zebraliśmy dane epidemiologiczne, kliniczne i diagnostyczne z każdego z pierwszych 10 przypadków prospektywnie w miarę ich identyfikacji. Okazy ze wszystkich przypadków przesyłano do lokalnych, wojewódzkich, krajowych i międzynarodowych laboratoriów w celu przeprowadzenia badań w celu zidentyfikowania czynnika etiologicznego. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie czesc 4

Radiogram klatki piersiowej ujawnił nacieki prawego górnego płata i bissasilarne śródmiąższowe; pomimo leczenia antybiotykami, pojawił się nieproduktywny kaszel i pogarszająca się duszność, wraz z hipotermią (temperatura 36,6 ° C) i nasyceniem tlenem wynoszącym 70% w powietrzu pokojowym. Został przyjęty na oddział intensywnej terapii z rozpoznaniem prawdopodobnego SARS i wymagał intubacji i wentylacji. Pomimo otrzymania antybiotyków o szerokim spektrum działania, oseltamiwiru, dożylnej rybawiryny i intensywnego wsparcia, zmarł 21 marca, 5 dni po przyjęciu do szpitala i 12 dni po rozpoczęciu choroby. Wykonano autopsję, której wyniki były w toku. Trzeci dodatkowy przypadek (w przypadku Pacjenta 9) nie był związany z tym klastrem rodzinnym. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie czesc 4”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie ad 8

Ponadto, RNA wyekstrahowano i przeprowadzono PCR z odwrotną transkrypcją (RT-PCR) dla celów specyficznych dla różnych wirusów RNA, w tym influenzawirusów A i B, syncytialnego wirusa oddechowego, podtypów 1, 2, 3 i 4 wirusa paragrypy, metapneumowirusa ludzkiego filowirusy (wirusy Ebola i Marburg), arenawirusy, wirus odry, wirus świnki, wirusy Hanta i wirus gorączki krwotocznej krymskiej-Kongo, dające negatywne wyniki. Przeprowadzono dalsze badania wirusologiczne na wszystkich próbkach oddechowych otrzymanych od 9 z 10 pacjentów. Obejmowały one hodowle wirusowe (w tym inokulację na hodowlę komórkową i jaja kurze z zarodkami oraz inokulację wewnątrzmózgową myszy karmionych piersią), mikroskopię elektronową odpornościową wymazów nosowo-gardłowych i płynów oskrzelowo-pęcherzykowych z surowicą otrzymaną podczas fazy rekonwalescencji z Pacjenta 10, RT-PCR dla konserwatywnych części gen polimerazy wirusów RNA i zagnieżdżony RT-PCR z degeneracyjnymi starterami swoistymi dla paramyksowirusów i buniawirusów. Wyniki wszystkich tych testów były ujemne, z dwoma wyjątkami. Ludzki metapneumowirus amplifikowano za pomocą zagnieżdżonego RT-PCR z płynu płuczącego oskrzelowo-pęcherzykowego i wymazów z nosogardzieli z pięciu z dziewięciu pacjentów z SARS i z wymazu z nosa i gardła od bezobjawowego kontaktu jednego z pacjentów w Toronto (Pacjent 3) z użyciem następującego startera para: 5 CTTTGGACTTAATGACAGATG3 i 5 GTCTTCCTGTGCTAACTTTG3 .4 W celu potwierdzenia tych pozytywnych wyników amplikony zostały zsekwencjonowane i uznane za unikalne, co wyklucza możliwość zanieczyszczenia krzyżowego w laboratorium. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie ad 8”

Leczenie gruźlicy u pacjentów z zaawansowanym zakażeniem ludzkim niedoborem odporności ad 6

Trzecim pacjentem był 40-letni homoseksualista z rozsianym gruźlicą, który z powodu złego przestrzegania zaleceń przez 13 miesięcy otrzymał równowartość 6-miesięcznego leczenia izoniazydem i ryfampiną oraz 2-miesięcznego leczenia pirazynamidem. M. tuberculosis oporny na rifampinę wyizolowano z plwociny i ropnia pachowego 10 tygodni po zakończeniu terapii. Dyskusja
Upośledzenie funkcji immunologicznej przez zakażenie HIV predysponuje pacjentów do różnych zakażeń, zmienia kliniczną prezentację infekcji i może komplikować terapię. Konieczna jest dożywotnia terapia zapobiegawcza po pomyślnym leczeniu szeregu zakażeń oportunistycznych związanych z AIDS, takich jak zapalenie płuc P. Read more „Leczenie gruźlicy u pacjentów z zaawansowanym zakażeniem ludzkim niedoborem odporności ad 6”

Wytwarzający aragazę guz płciowy, powodujący przedwczesny ginekomastię czesc 4

Poziom hormonu folikulotropowego i hormonu luteinizującego u pacjenta w moczu (Tabela 2) oraz jego podstawowe i szczytowe stężenia tych hormonów po podaniu hormonu uwalniającego gonadotropiny (zawartość podstawowa, <3 IU na litr, dla obu, szczyt, 10 i < 3 jm na litr odpowiednio dla hormonu luteinizującego i hormonu folikulotropowego) dotyczyły normalnego chłopca w stadium przed pokwitaniem. Wyniki te wykluczają takie przyczyny ginekomastii jak prawdziwe przedwczesne dojrzewanie, ektopowe wytwarzanie gonadotropin i wrodzony przerost nadnerczy (poziom 17-hydroksyprogesteronu w surowicy również był prawidłowy). Odkrycia sugerują, że ginekomastia pacjenta i zaawansowany wiek kostny były spowodowane izolowanym wzrostem produkcji estrogenu. Jedenaście miesięcy leczenia testolaktonem spowodowało pewne spowolnienie prędkości wzrostu, ale nieznaczne ograniczenie szybko postępującego wieku kostnego (Tabela 1); konieczna jest dalsza obserwacja leczenia medroksyprogesteronem w celu oceny jego skuteczności w ograniczaniu przyspieszenia wzrostu. Poziom wszystkich zmierzonych sterydów pozostawał niski podczas leczenia środkiem progestagenowym, chociaż wydalanie z moczem hormonu luteinizującego nieznacznie wzrosło (Tabela 2). Read more „Wytwarzający aragazę guz płciowy, powodujący przedwczesny ginekomastię czesc 4”

Zatrzymanie oddechu w astmie o skrajnej śmiertelności

DUŻA liczba poprzednich badań, wiele z natury epidemiologicznych, 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 badali narastający problem śmierci z powodu astmy. Chociaż badania te zidentyfikowały takie zgony jako główny problem polityki zdrowotnej, na ogół nie wyjaśniły procesów patofizjologicznych i mechanizmów powodujących śmierć. Główną przyczyną tego braku danych jest to, że większość zgonów związanych z astmą poprzedza gwałtowne i poważne pogorszenie 23, a wiele z nich ma miejsce poza szpitalem1. Tak więc, tak ważna i fundamentalna kwestia jak względna rola arytmii i zaburzeń rytmu serca asfiksja powodująca te zgony pozostaje kontrowersyjna. W tym badaniu sprawdziliśmy, jak i dlaczego pacjenci umierają w ostrych zaostrzeniach astmy poza szpitalem. Read more „Zatrzymanie oddechu w astmie o skrajnej śmiertelności”

Tacrine jako leczenie otępienia typu Alzheimer – odpowiedź Summersa i Al.

Dla redaktora: Oświadczenie z wydziału oceny i badań narkotyków FDA jest ciekawe. To, co omawia to zdanie, jest godne uwagi. Intensywne 3/2-letnie badanie naszych danych przez dział zgodności FDA nie zniosło żadnego z naszych wniosków. Podział poprosił nas o wyjaśnienie pewnych kwestii dotyczących naszej oryginalnej pracy. To zrobiliśmy w liście z 851 słowami, które zostało zredagowane przez dział zgodności FDA, a następnie w kwietniu 1989 r. Read more „Tacrine jako leczenie otępienia typu Alzheimer – odpowiedź Summersa i Al.”

Cyklosporyna w łuszczycy typu plaque – wyniki wielodawkowego, podwójnie ślepej próby

Skuteczność cyklosporyny w leczeniu łuszczycy była nieoczekiwanym odkryciem Muellera i Herrmanna1, którzy obejmowali czterech pacjentów z łuszczycowym zapaleniem stawów i łuszczycą w badaniu dotyczącym leczenia reumatoidalnego zapalenia stawów. Potwierdziliśmy to w podwójnie ślepej próbie skuteczności cyklosporyny w łuszczycy.2 Skuteczne dawki cyklosporyny podawane pacjentom z łuszczycą w tych i innych badaniach wahały się od do 15 mg na kilogram masy ciała na dobę.1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Ponieważ raporty opierały się głównie na badaniach niewielkiej liczby pacjentów, trudno było określić właściwą dawkę. Dlatego przeprowadziliśmy 16-tygodniową, podwójnie ślepą próbę odpowiedzi na dawkę w jednym ośrodku badawczym, aby określić skuteczność trzech dawek cyklosporyny u 85 pacjentów z łuszczycą. Ponadto ocenialiśmy kliniczne i laboratoryjne skutki uboczne każdej dawki, a u 43 pacjentów ocenialiśmy czynność nerek (jak opisano poniżej).
Metody
Pacjenci
Osiemdziesiąt pięć pacjentów (66 mężczyzn i 19 kobiet, średni wiek, 44 lata, zakres od 19 do 74), zostało włączonych do tego ambulatoryjnego badania. Read more „Cyklosporyna w łuszczycy typu plaque – wyniki wielodawkowego, podwójnie ślepej próby”

Kortykosteroidy u dzieci z uszkodzeniem przełyku przełyku

W badaniu Anderson i in. (Wydanie 6 września) * Zauważyłem, że esophagoscopy wykonywane u wszystkich dzieci zostały wykonane ze sztywnymi esophagoscopes. W dniu dzisiejszej enophagoskopii włóknistej zastanawiam się, dlaczego badanie przeprowadzono przy użyciu sztywnego przełyku, a także zastanawiam się nad jakością wizualizacji uzyskanej za pomocą sztywnego przełyku i czy zastosowanie światłowodowego elastycznego przełyku zmieniło kryteria wizualizacji i wpłynęło na ilość wykrytych obrażeń.
KT Shah, MD
6550 Mapleridge, Houston, TX 77081
* Anderson KD, Rouse TM, Randolph JG. Kontrolowane badanie kortykosteroidów u dzieci z korozyjnym uszkodzeniem przełyku. Read more „Kortykosteroidy u dzieci z uszkodzeniem przełyku przełyku”