Przypadek 27-2002: późnokomórkowa infekcyjna neuronalna lipofuscyoza Ceroidów

Rust i Karluk (wydanie 29 sierpnia) omawiają przypadek dziecka z zaburzeniem neurodegeneracyjnym, u którego stwierdzono krzywoliniowe cienie inkluzji lizosomalnych na podstawie analizy mikroskopowej elektronowej próbki z biopsji mięśniowej. Rozpoznano późną infekcyjną neuronalną ceroidalną lipofuscyozę. Podejście do potwierdzenia tej diagnozy jest zastanawiające.
Autorzy wspominają, że kolejne testy molekularne dla dwóch powszechnych mutacji CLN2 nie pozwoliły na zidentyfikowanie mutacji, ale nie przeprowadzono testów enzymatycznych. Biorąc pod uwagę fakt, że tylko 66 procent pacjentów z klinicznie rozpoznaną późną infekcją neuronalnej infekcyjnej lipofuscykozy ceroidowej ma mutacje w CLN2, 2 bardziej ostrożnym podejściem byłoby po pierwsze udokumentowanie niedoboru enzymu tripeptydylo-peptydazy I (TPP-I) , produkt białkowy CLN2. Read more „Przypadek 27-2002: późnokomórkowa infekcyjna neuronalna lipofuscyoza Ceroidów”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie

Ciężki zespół ostrej niewydolności oddechowej (SARS) to stan nieznanej przyczyny, który niedawno został rozpoznany u pacjentów w Azji, Ameryce Północnej i Europie. W niniejszym raporcie podsumowano wstępne ustalenia epidemiologiczne, opis kliniczny i ustalenia diagnostyczne, które nastąpiły po identyfikacji SARS w Kanadzie. Metody
SARS został po raz pierwszy zidentyfikowany w Kanadzie na początku marca 2003 r. Zebraliśmy dane epidemiologiczne, kliniczne i diagnostyczne z każdego z pierwszych 10 przypadków prospektywnie w miarę ich identyfikacji. Okazy ze wszystkich przypadków przesyłano do lokalnych, wojewódzkich, krajowych i międzynarodowych laboratoriów w celu przeprowadzenia badań w celu zidentyfikowania czynnika etiologicznego. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie czesc 4

Radiogram klatki piersiowej ujawnił nacieki prawego górnego płata i bissasilarne śródmiąższowe; pomimo leczenia antybiotykami, pojawił się nieproduktywny kaszel i pogarszająca się duszność, wraz z hipotermią (temperatura 36,6 ° C) i nasyceniem tlenem wynoszącym 70% w powietrzu pokojowym. Został przyjęty na oddział intensywnej terapii z rozpoznaniem prawdopodobnego SARS i wymagał intubacji i wentylacji. Pomimo otrzymania antybiotyków o szerokim spektrum działania, oseltamiwiru, dożylnej rybawiryny i intensywnego wsparcia, zmarł 21 marca, 5 dni po przyjęciu do szpitala i 12 dni po rozpoczęciu choroby. Wykonano autopsję, której wyniki były w toku. Trzeci dodatkowy przypadek (w przypadku Pacjenta 9) nie był związany z tym klastrem rodzinnym. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie czesc 4”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie ad 8

Ponadto, RNA wyekstrahowano i przeprowadzono PCR z odwrotną transkrypcją (RT-PCR) dla celów specyficznych dla różnych wirusów RNA, w tym influenzawirusów A i B, syncytialnego wirusa oddechowego, podtypów 1, 2, 3 i 4 wirusa paragrypy, metapneumowirusa ludzkiego filowirusy (wirusy Ebola i Marburg), arenawirusy, wirus odry, wirus świnki, wirusy Hanta i wirus gorączki krwotocznej krymskiej-Kongo, dające negatywne wyniki. Przeprowadzono dalsze badania wirusologiczne na wszystkich próbkach oddechowych otrzymanych od 9 z 10 pacjentów. Obejmowały one hodowle wirusowe (w tym inokulację na hodowlę komórkową i jaja kurze z zarodkami oraz inokulację wewnątrzmózgową myszy karmionych piersią), mikroskopię elektronową odpornościową wymazów nosowo-gardłowych i płynów oskrzelowo-pęcherzykowych z surowicą otrzymaną podczas fazy rekonwalescencji z Pacjenta 10, RT-PCR dla konserwatywnych części gen polimerazy wirusów RNA i zagnieżdżony RT-PCR z degeneracyjnymi starterami swoistymi dla paramyksowirusów i buniawirusów. Wyniki wszystkich tych testów były ujemne, z dwoma wyjątkami. Ludzki metapneumowirus amplifikowano za pomocą zagnieżdżonego RT-PCR z płynu płuczącego oskrzelowo-pęcherzykowego i wymazów z nosogardzieli z pięciu z dziewięciu pacjentów z SARS i z wymazu z nosa i gardła od bezobjawowego kontaktu jednego z pacjentów w Toronto (Pacjent 3) z użyciem następującego startera para: 5 CTTTGGACTTAATGACAGATG3 i 5 GTCTTCCTGTGCTAACTTTG3 .4 W celu potwierdzenia tych pozytywnych wyników amplikony zostały zsekwencjonowane i uznane za unikalne, co wyklucza możliwość zanieczyszczenia krzyżowego w laboratorium. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie ad 8”

Leczenie gruźlicy u pacjentów z zaawansowanym zakażeniem ludzkim niedoborem odporności cd

Wskaźniki pozytywnych kwasowo-szybkich wymazów i hodowli dla M. tuberculosis dla różnych próbek przedstawiono w Tabeli 3. Ogólnie, połączenie badania wykrwawionych i indukowanych próbek plwociny i próbek płukania oskrzelowo-pęcherzykowego dało diagnozę gruźlicy w 98% przypadków. pacjenci z zajęciem płucnym. Diagnozę wykonano w hodowli tkanek przezskórnych-biopsyjnych u dwóch pacjentów, którzy mieli negatywne plwociny i płukanie oskrzelowo-pęcherzykowe. Read more „Leczenie gruźlicy u pacjentów z zaawansowanym zakażeniem ludzkim niedoborem odporności cd”

Wytwarzający aragazę guz płciowy, powodujący przedwczesny ginekomastię cd

Indeks ten został użyty do wskazania ilości produktu w porównaniu z ilością substratu. Stężenie hormonu luteinizującego i hormonu folikulotropowego mierzono za pomocą testu radioimmunologicznego przed i po podaniu 25 .g hormonu uwalniającego gonadotropinę na metr kwadratowy.15 Odpowiedź jądra na 2500 jm ludzkiej gonadotropiny kosmówkowej określano przez pomiary testosteronu i estradiolu w surowicy. próbki otrzymane 15, 48 i 60 godzin po wstrzyknięciu.7
Wykrywanie aktywności aromatazy
Analiza biochemiczna
Aktywność aromatazy mierzono w homogenatach ludzkiej tkanki raka sutka i nowotworze płodu płciowego jąder (w tym pewnej normalnie sąsiadującej tkance jąder) i frakcjach mikrosomalnych ludzkiego łożyska za pomocą testu Siiteri i wsp., Zmodyfikowanego nieznacznie. zastosowanym substratem było 300 nM [3H] androstenedione (New England Nuclear, Boston). Tkankę homogenizowano w homogenizatorze Polytron (Brinkman Instruments, Westbury, NY); po trzech 15-sekundowych wybuchach homogenizacji próbki umieszczono na lodzie na minutę. Read more „Wytwarzający aragazę guz płciowy, powodujący przedwczesny ginekomastię cd”

Wytwarzający aragazę guz płciowy, powodujący przedwczesny ginekomastię ad

Funkcja tarczycy była normalna. USG jamy brzusznej i tomografia komputerowa nie wykazały nieprawidłowości w nadnerczach lub innych strukturach; czaszkowa tomografia komputerowa również była normalna. Badanie ultrasonograficzne jąder wykazało łagodne obustronne powiększenie gonad (ze względu na wiek) i niejednorodną teksturę.6 W ciągu kolejnych dziewięciu miesięcy pacjent urósł 6,8 cm (co odpowiada 9,2 cm rocznie), a powiększenie piersi zwiększyło się do wzrostu u dziewczynek w średnim wieku (stadium III Tannera). Włosy łonowe nadal były nieobecne. Wyniki trzydniowego testu stymulacji kosmówkowej gonadotropiny były normalne dla chłopca w jego wieku.7 Powtarzane badanie ultrasonograficzne jąder wykazało trwałe powiększenie na wiek (prawe jądro, 2,7 na 1,3 na 1,7 cm, lewe jądro, 2,9 na 1,3 na 2,3 cm ) i ogniskowe obszary o zwiększonej echogeniczności. Read more „Wytwarzający aragazę guz płciowy, powodujący przedwczesny ginekomastię ad”

Górna granica fizjologicznego przerostu mięśnia sercowego u wysoko wyszkolonych sportowców elitarnych ad 7

Niemniej jednak, każda z tych kobiet miała grubość ściany lewej komory . 11 mm. Obserwacja ta sugeruje, że u zawodniczek wzrost grubości ścianek lewej komory związany z intensywnym treningiem praktycznie nigdy nie prowadzi do grubości ścian w zakresie zgodnym z rozpoznaniem kardiomiopatii przerostowej. Uważamy za bardzo mało prawdopodobne, aby którykolwiek z naszych sportowców o grubości ścianek 3 = 13 mm miał kardiomiopatię przerostową. Żadna z nich nie miała innych objawów sugerujących tę chorobę, takich jak wywiad rodzinny z przerostową kardiomiopatią lub nagłą śmiercią, objawy sercowe podczas wysiłku, dowody na dynamiczną niedrożność podortaniową lub nieprawidłowy wzorzec wypełnienia lewej komory serca. Read more „Górna granica fizjologicznego przerostu mięśnia sercowego u wysoko wyszkolonych sportowców elitarnych ad 7”

Górna granica fizjologicznego przerostu mięśnia sercowego u wysoko wyszkolonych sportowców elitarnych ad 5

Średnie wartości wskaźników rozkurczowych dopplerowskich w tej grupie zawodników były następujące: szczytowa wczesna rozkurczowa prędkość przepływu, 69 . 12 cm na sekundę; szczytowa prędkość przepływu podczas skurczu przedsionkowego, 30 . 8 cm na sekundę; stosunek wczesnych do późnych szczytów prędkości przepływu, 2,2 . 0,4; i nachylenie zejścia wczesnego rozkurczowego piku, 501 . 84 mm na sekundę do kwadratu. Read more „Górna granica fizjologicznego przerostu mięśnia sercowego u wysoko wyszkolonych sportowców elitarnych ad 5”

Zatrzymanie oddechu w astmie o skrajnej śmiertelności czesc 4

W związku z tym są one prawdopodobnie reprezentatywne dla podgrupy pacjentów, którzy umierają na astmę.5 Chociaż nie stwierdziliśmy zagrażających życiu zaburzeń rytmu serca u naszych pacjentów, można by twierdzić, że monitorowanie elektrokardiograficzne nie rozpoczęło się wystarczająco szybko, tak że arytmie, jeśli istnieją, zniknęły natychmiast po podaniu hiperoksycznych mieszanin gazu. Z powodów etycznych nie wykonywaliśmy elektrokardiografii przed podaniem tlenu. Jednak nie uważamy, aby to niewielkie opóźnienie miało istotny wpływ na nasze wyniki, ponieważ takie arytmie, jeśli były obecne, nie zmieniały tętna ani ciśnienia krwi. Z wyjątkiem dwóch pacjentów, zarówno częstość akcji serca, jak i ciśnienie krwi pozostały względnie niezmienione podczas resuscytacji. Ponadto, jeśli wystąpiły arytmie, które powróciły do prawidłowego rytmu zatokowego po kilku minutach wentylacji i dotlenienia, wówczas leżącym u podłoża procesem patofizjologicznym był prawdopodobnie niedotlenienie, a nie pierwotne zaburzenie rytmu serca. Read more „Zatrzymanie oddechu w astmie o skrajnej śmiertelności czesc 4”