Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie czesc 4

Radiogram klatki piersiowej ujawnił nacieki prawego górnego płata i bissasilarne śródmiąższowe; pomimo leczenia antybiotykami, pojawił się nieproduktywny kaszel i pogarszająca się duszność, wraz z hipotermią (temperatura 36,6 ° C) i nasyceniem tlenem wynoszącym 70% w powietrzu pokojowym. Został przyjęty na oddział intensywnej terapii z rozpoznaniem prawdopodobnego SARS i wymagał intubacji i wentylacji. Pomimo otrzymania antybiotyków o szerokim spektrum działania, oseltamiwiru, dożylnej rybawiryny i intensywnego wsparcia, zmarł 21 marca, 5 dni po przyjęciu do szpitala i 12 dni po rozpoczęciu choroby. Wykonano autopsję, której wyniki były w toku. Trzeci dodatkowy przypadek (w przypadku Pacjenta 9) nie był związany z tym klastrem rodzinnym. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie czesc 4”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie ad 8

Ponadto, RNA wyekstrahowano i przeprowadzono PCR z odwrotną transkrypcją (RT-PCR) dla celów specyficznych dla różnych wirusów RNA, w tym influenzawirusów A i B, syncytialnego wirusa oddechowego, podtypów 1, 2, 3 i 4 wirusa paragrypy, metapneumowirusa ludzkiego filowirusy (wirusy Ebola i Marburg), arenawirusy, wirus odry, wirus świnki, wirusy Hanta i wirus gorączki krwotocznej krymskiej-Kongo, dające negatywne wyniki. Przeprowadzono dalsze badania wirusologiczne na wszystkich próbkach oddechowych otrzymanych od 9 z 10 pacjentów. Obejmowały one hodowle wirusowe (w tym inokulację na hodowlę komórkową i jaja kurze z zarodkami oraz inokulację wewnątrzmózgową myszy karmionych piersią), mikroskopię elektronową odpornościową wymazów nosowo-gardłowych i płynów oskrzelowo-pęcherzykowych z surowicą otrzymaną podczas fazy rekonwalescencji z Pacjenta 10, RT-PCR dla konserwatywnych części gen polimerazy wirusów RNA i zagnieżdżony RT-PCR z degeneracyjnymi starterami swoistymi dla paramyksowirusów i buniawirusów. Wyniki wszystkich tych testów były ujemne, z dwoma wyjątkami. Ludzki metapneumowirus amplifikowano za pomocą zagnieżdżonego RT-PCR z płynu płuczącego oskrzelowo-pęcherzykowego i wymazów z nosogardzieli z pięciu z dziewięciu pacjentów z SARS i z wymazu z nosa i gardła od bezobjawowego kontaktu jednego z pacjentów w Toronto (Pacjent 3) z użyciem następującego startera para: 5 CTTTGGACTTAATGACAGATG3 i 5 GTCTTCCTGTGCTAACTTTG3 .4 W celu potwierdzenia tych pozytywnych wyników amplikony zostały zsekwencjonowane i uznane za unikalne, co wyklucza możliwość zanieczyszczenia krzyżowego w laboratorium. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie ad 8”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie

Ciężki zespół ostrej niewydolności oddechowej (SARS) to stan nieznanej przyczyny, który niedawno został rozpoznany u pacjentów w Azji, Ameryce Północnej i Europie. W niniejszym raporcie podsumowano wstępne ustalenia epidemiologiczne, opis kliniczny i ustalenia diagnostyczne, które nastąpiły po identyfikacji SARS w Kanadzie. Metody
SARS został po raz pierwszy zidentyfikowany w Kanadzie na początku marca 2003 r. Zebraliśmy dane epidemiologiczne, kliniczne i diagnostyczne z każdego z pierwszych 10 przypadków prospektywnie w miarę ich identyfikacji. Okazy ze wszystkich przypadków przesyłano do lokalnych, wojewódzkich, krajowych i międzynarodowych laboratoriów w celu przeprowadzenia badań w celu zidentyfikowania czynnika etiologicznego. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie”

Przypadek 27-2002: późnokomórkowa infekcyjna neuronalna lipofuscyoza Ceroidów

Rust i Karluk (wydanie 29 sierpnia) omawiają przypadek dziecka z zaburzeniem neurodegeneracyjnym, u którego stwierdzono krzywoliniowe cienie inkluzji lizosomalnych na podstawie analizy mikroskopowej elektronowej próbki z biopsji mięśniowej. Rozpoznano późną infekcyjną neuronalną ceroidalną lipofuscyozę. Podejście do potwierdzenia tej diagnozy jest zastanawiające.
Autorzy wspominają, że kolejne testy molekularne dla dwóch powszechnych mutacji CLN2 nie pozwoliły na zidentyfikowanie mutacji, ale nie przeprowadzono testów enzymatycznych. Biorąc pod uwagę fakt, że tylko 66 procent pacjentów z klinicznie rozpoznaną późną infekcją neuronalnej infekcyjnej lipofuscykozy ceroidowej ma mutacje w CLN2, 2 bardziej ostrożnym podejściem byłoby po pierwsze udokumentowanie niedoboru enzymu tripeptydylo-peptydazy I (TPP-I) , produkt białkowy CLN2. Read more „Przypadek 27-2002: późnokomórkowa infekcyjna neuronalna lipofuscyoza Ceroidów”

Nature Cures: Historia Medycyny Alternatywnej w Ameryce ad

Był to czas, kiedy chirurdzy dokonywali cudów; teoria zarazków choroby została zaakceptowana, ale wciąż niewiele było skutecznych leków. Był to również okres gorzkiego konfliktu między stałymi bywalcami a nieregularnikami, kiedy ten pierwszy – reagując na raport Flexnera (edukacja medyczna w Stanach Zjednoczonych i Kanadzie, New York: Carnegie Foundation for Advocement of Teaching, 1910) – zaczął oczyścić swój własny dom i przywrócić państwowe prawa licencyjne, z których usunęła się walońska demokracja. Każda strona nakładała na drugą ekstrawaganckie obelgi. Trzecia część książki The Late Twentieth Century: Holistic Healing może być najtrudniejszym i, jak już wspomniano, najbardziej kontrowersyjnym. Ostatnia ankieta przeprowadzona przez Eisenberga i współpracowników ma pięć lat ( Trendy w medycynie alternatywnej w Stanach Zjednoczonych, 1990-1997. Read more „Nature Cures: Historia Medycyny Alternatywnej w Ameryce ad”