Przypadek 27-2002: późnokomórkowa infekcyjna neuronalna lipofuscyoza Ceroidów

Rust i Karluk (wydanie 29 sierpnia) omawiają przypadek dziecka z zaburzeniem neurodegeneracyjnym, u którego stwierdzono krzywoliniowe cienie inkluzji lizosomalnych na podstawie analizy mikroskopowej elektronowej próbki z biopsji mięśniowej. Rozpoznano późną infekcyjną neuronalną ceroidalną lipofuscyozę. Podejście do potwierdzenia tej diagnozy jest zastanawiające.
Autorzy wspominają, że kolejne testy molekularne dla dwóch powszechnych mutacji CLN2 nie pozwoliły na zidentyfikowanie mutacji, ale nie przeprowadzono testów enzymatycznych. Biorąc pod uwagę fakt, że tylko 66 procent pacjentów z klinicznie rozpoznaną późną infekcją neuronalnej infekcyjnej lipofuscykozy ceroidowej ma mutacje w CLN2, 2 bardziej ostrożnym podejściem byłoby po pierwsze udokumentowanie niedoboru enzymu tripeptydylo-peptydazy I (TPP-I) , produkt białkowy CLN2. Read more „Przypadek 27-2002: późnokomórkowa infekcyjna neuronalna lipofuscyoza Ceroidów”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie

Ciężki zespół ostrej niewydolności oddechowej (SARS) to stan nieznanej przyczyny, który niedawno został rozpoznany u pacjentów w Azji, Ameryce Północnej i Europie. W niniejszym raporcie podsumowano wstępne ustalenia epidemiologiczne, opis kliniczny i ustalenia diagnostyczne, które nastąpiły po identyfikacji SARS w Kanadzie. Metody
SARS został po raz pierwszy zidentyfikowany w Kanadzie na początku marca 2003 r. Zebraliśmy dane epidemiologiczne, kliniczne i diagnostyczne z każdego z pierwszych 10 przypadków prospektywnie w miarę ich identyfikacji. Okazy ze wszystkich przypadków przesyłano do lokalnych, wojewódzkich, krajowych i międzynarodowych laboratoriów w celu przeprowadzenia badań w celu zidentyfikowania czynnika etiologicznego. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie czesc 4

Radiogram klatki piersiowej ujawnił nacieki prawego górnego płata i bissasilarne śródmiąższowe; pomimo leczenia antybiotykami, pojawił się nieproduktywny kaszel i pogarszająca się duszność, wraz z hipotermią (temperatura 36,6 ° C) i nasyceniem tlenem wynoszącym 70% w powietrzu pokojowym. Został przyjęty na oddział intensywnej terapii z rozpoznaniem prawdopodobnego SARS i wymagał intubacji i wentylacji. Pomimo otrzymania antybiotyków o szerokim spektrum działania, oseltamiwiru, dożylnej rybawiryny i intensywnego wsparcia, zmarł 21 marca, 5 dni po przyjęciu do szpitala i 12 dni po rozpoczęciu choroby. Wykonano autopsję, której wyniki były w toku. Trzeci dodatkowy przypadek (w przypadku Pacjenta 9) nie był związany z tym klastrem rodzinnym. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie czesc 4”

Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie ad 8

Ponadto, RNA wyekstrahowano i przeprowadzono PCR z odwrotną transkrypcją (RT-PCR) dla celów specyficznych dla różnych wirusów RNA, w tym influenzawirusów A i B, syncytialnego wirusa oddechowego, podtypów 1, 2, 3 i 4 wirusa paragrypy, metapneumowirusa ludzkiego filowirusy (wirusy Ebola i Marburg), arenawirusy, wirus odry, wirus świnki, wirusy Hanta i wirus gorączki krwotocznej krymskiej-Kongo, dające negatywne wyniki. Przeprowadzono dalsze badania wirusologiczne na wszystkich próbkach oddechowych otrzymanych od 9 z 10 pacjentów. Obejmowały one hodowle wirusowe (w tym inokulację na hodowlę komórkową i jaja kurze z zarodkami oraz inokulację wewnątrzmózgową myszy karmionych piersią), mikroskopię elektronową odpornościową wymazów nosowo-gardłowych i płynów oskrzelowo-pęcherzykowych z surowicą otrzymaną podczas fazy rekonwalescencji z Pacjenta 10, RT-PCR dla konserwatywnych części gen polimerazy wirusów RNA i zagnieżdżony RT-PCR z degeneracyjnymi starterami swoistymi dla paramyksowirusów i buniawirusów. Wyniki wszystkich tych testów były ujemne, z dwoma wyjątkami. Ludzki metapneumowirus amplifikowano za pomocą zagnieżdżonego RT-PCR z płynu płuczącego oskrzelowo-pęcherzykowego i wymazów z nosogardzieli z pięciu z dziewięciu pacjentów z SARS i z wymazu z nosa i gardła od bezobjawowego kontaktu jednego z pacjentów w Toronto (Pacjent 3) z użyciem następującego startera para: 5 CTTTGGACTTAATGACAGATG3 i 5 GTCTTCCTGTGCTAACTTTG3 .4 W celu potwierdzenia tych pozytywnych wyników amplikony zostały zsekwencjonowane i uznane za unikalne, co wyklucza możliwość zanieczyszczenia krzyżowego w laboratorium. Read more „Identyfikacja zespołu ciężkiej ostrej niewydolności oddechowej w Kanadzie ad 8”

Leczenie gruźlicy u pacjentów z zaawansowanym zakażeniem ludzkim niedoborem odporności cd

Wskaźniki pozytywnych kwasowo-szybkich wymazów i hodowli dla M. tuberculosis dla różnych próbek przedstawiono w Tabeli 3. Ogólnie, połączenie badania wykrwawionych i indukowanych próbek plwociny i próbek płukania oskrzelowo-pęcherzykowego dało diagnozę gruźlicy w 98% przypadków. pacjenci z zajęciem płucnym. Diagnozę wykonano w hodowli tkanek przezskórnych-biopsyjnych u dwóch pacjentów, którzy mieli negatywne plwociny i płukanie oskrzelowo-pęcherzykowe. Read more „Leczenie gruźlicy u pacjentów z zaawansowanym zakażeniem ludzkim niedoborem odporności cd”

Górna granica fizjologicznego przerostu mięśnia sercowego u wysoko wyszkolonych sportowców elitarnych ad 6

Jednak górne granice, na które można zwiększyć grubość ściany lewej komory przez trening lekkoatletyczny, pozostają nieznane, ponieważ większość wcześniejszych badań echokardiograficznych koncentrowało się na wartościach średnich dla wymiarów serca u stosunkowo niewielkich grup sportowców.10 11 12 13 14 15 16, 18, 21 Aby wyjaśnić dwuznaczności diagnostyczne między fizjologicznym wzrostem grubości ściany lewej komory a patologicznym przerostem, określiliśmy górną granicę grubości ściany lewej komory w populacji prawie 1000 elitarnych sportowców poddawanych systematycznym i intensywnym treningom . Najwyższa wartość grubości ściany w badanej populacji wynosiła 16 mm. Ponadto okazało się, że szczególnie rzadka jest grubość ścianki zgodna z rozpoznaniem kardiomiopatii przerostowej (. 13 mm); został zidentyfikowany w mniej niż 2 procent naszych sportowców. Co więcej, ta ekstremalna morfologiczna ekspresja serca sportowca wydawała się praktycznie ograniczona do sportowców trenujących sporty wioślarskie, ponieważ 15 z 16 sportowców o grubości ściany tej wielkości było wioślarzami lub kajakarzami, a szesnasty był rowerzystą. Read more „Górna granica fizjologicznego przerostu mięśnia sercowego u wysoko wyszkolonych sportowców elitarnych ad 6”

Górna granica fizjologicznego przerostu mięśnia sercowego u wysoko wyszkolonych sportowców elitarnych czesc 4

Czterokomorowy widok wierzchołkowy (panel B) u 24-letniego kajakarza (zawodnik 13) wykazuje przerost w rejonie wierzchołka lewej komory (strzałki); maksymalna grubość lewej komory serca uwidoczniona w płaszczyznach przymostkowych wynosiła 15 mm. RA oznacza prawe przedsionek; inne skróty są zdefiniowane w legendzie do rysunku 2. Tabela 3. Tabela 3. Echokardiograficzne wyniki u 16 elitarnych sportowców płci męskiej z najczęściej zaznaczonym zagęszczeniem lewej komory. Read more „Górna granica fizjologicznego przerostu mięśnia sercowego u wysoko wyszkolonych sportowców elitarnych czesc 4”

Zatrzymanie oddechu w astmie o skrajnej śmiertelności czesc 4

W związku z tym są one prawdopodobnie reprezentatywne dla podgrupy pacjentów, którzy umierają na astmę.5 Chociaż nie stwierdziliśmy zagrażających życiu zaburzeń rytmu serca u naszych pacjentów, można by twierdzić, że monitorowanie elektrokardiograficzne nie rozpoczęło się wystarczająco szybko, tak że arytmie, jeśli istnieją, zniknęły natychmiast po podaniu hiperoksycznych mieszanin gazu. Z powodów etycznych nie wykonywaliśmy elektrokardiografii przed podaniem tlenu. Jednak nie uważamy, aby to niewielkie opóźnienie miało istotny wpływ na nasze wyniki, ponieważ takie arytmie, jeśli były obecne, nie zmieniały tętna ani ciśnienia krwi. Z wyjątkiem dwóch pacjentów, zarówno częstość akcji serca, jak i ciśnienie krwi pozostały względnie niezmienione podczas resuscytacji. Ponadto, jeśli wystąpiły arytmie, które powróciły do prawidłowego rytmu zatokowego po kilku minutach wentylacji i dotlenienia, wówczas leżącym u podłoża procesem patofizjologicznym był prawdopodobnie niedotlenienie, a nie pierwotne zaburzenie rytmu serca. Read more „Zatrzymanie oddechu w astmie o skrajnej śmiertelności czesc 4”

Kto żyje Kto umiera : Etyczne kryteria wyboru pacjentów Silna medycyna: Etyczne racjonowanie opieki zdrowotnej ad

Zamiast tego identyfikuje rozwiązanie w koncepcji wcześniejszej zgody pacjenta. Chodzi o to, że pacjenci powinni decydować, w jaki sposób przydzielane są ich życiowe zasoby. Twierdzi, że racjonowanie jest dopuszczalne, gdy ktoś subskrybuje polisę ubezpieczenia zdrowotnego, która wyraźnie ogranicza zasięg – na przykład w przypadku przeszczepów narządów. Jego model uprzedniej zgody zależy również od domniemanej zgody w wielu sytuacjach, jak w przypadku osoby, która kupuje polisę ubezpieczenia zdrowotnego z określonymi wyjątkami. Menzel utrzymuje, że takie podejście pozwala na racjonowanie bez moralnego zaniedbania pacjenta, nalega, aby pacjent, któremu odmówiono opieki, uprzednio uzgodnił, że inne życia powinny zostać uratowane przed własną opieką, i stwierdza, że opieka może być wstrzymana bez jakiekolwiek oszustwo pacjenta: Rozróżniający dostawcy mogą racjonować swoją opiekę z czystym sumieniem, nawet rozsądny ekonomista może przyjąć swoją przysięgę Hipokratesa . Read more „Kto żyje Kto umiera : Etyczne kryteria wyboru pacjentów Silna medycyna: Etyczne racjonowanie opieki zdrowotnej ad”

Ocena nowych technologii

Oświecające spojrzenie Fuchsa i Garbera na nową ocenę technologii (wydanie z 6 września) * wyraźnie pokazuje zasady w niej zawarte i, chociaż wyrażają właściwą troskę o wartość życia (w dużej mierze osąd osobisty, a czasem głęboki), pozostawia społeczny ceny nietknięte. Ponieważ duża opieka medyczna w zachodnim uprzemysłowionym świecie jest bezpłatna lub prawie w punkcie konsumpcji przez indywidualnego pacjenta, nie podlega zwykłym czynnikom ekonomicznym.
Kiedy trudność jest przede wszystkim kosztem nieosiągalnym, modele społeczne zarządzania zdrowiem będą nadal mylić problem, chyba że uwzględni się ceny życia. Wrażliwość opinii publicznej i lekarzy na ten temat wydaje się niewłaściwa, gdy ustalone metody powierzone prawu, wojsku i aktuariuszom codziennie obciążają ryzyko i koszty życia, śmierci i niepełnosprawności. Kiedy poszukiwane są podejścia do kalkulacji kosztów, rozsądne wydaje się zastosowanie realnej liczby do pieniężnej ceny życia, aby ukończyć model matematyczny i osiągnąć pewne skończone ilości, aby pomóc nam rozstrzygnąć osądy skali. Read more „Ocena nowych technologii”